WormMine: Gene WBGene00039184

• WormBase Gene ID: WBGene00039184
• Gene Name: CBG20114
• Sequence Name: CBG20114
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans lam-1. In C. elegans, lam-1 is involved in pharynx development and positive regulation of locomotion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20114.1	CBG20114.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20114	CBG20114		[unknown]

0 RNAi Result

24 Allele

• WBVar00128223
• WBVar00128222
• WBVar00128221
• WBVar00128220
• WBVar00128227
• WBVar00128226
• WBVar00128225
• WBVar00128224
• WBVar00128241
• WBVar00128240
• WBVar00128243
• WBVar00128242
• WBVar00128239
• WBVar00128230
• WBVar00128234
• WBVar00128233
• WBVar00128232
• WBVar00128231
• WBVar00128238
• WBVar00128237
• WBVar00128236
• WBVar00128235
• WBVar00128229
• WBVar00128228

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054241
• Remark: CBG20114, GGAGTCAAGGTGGAATATCTCCAGATTTCGGAATCAGCTAAGAATGCGTTGACTACTGTA, WBGene00039184
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term