WormMine: Gene WBGene00039121

• WormBase Gene ID: WBGene00039121
• Gene Name: CBG20017
• Sequence Name: CBG20017
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-spr-4 based on RNA-seq studies. Is an ortholog of C. elegans C33A12.19.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20017.1	CBG20017.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20017	CBG20017		[unknown]

0 RNAi Result

20 Allele

• WBVar00128031
• WBVar00128030
• WBVar00128021
• WBVar00128020
• WBVar00128025
• WBVar00128024
• WBVar00128023
• WBVar00128022
• WBVar00128029
• WBVar00128028
• WBVar00128027
• WBVar00128026
• WBVar00128019
• WBVar00128014
• WBVar00128013
• WBVar00128012
• WBVar00128018
• WBVar00128017
• WBVar00128016
• WBVar00128015

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1059836
• Remark: CBG20017, GACGAAAAAGGATGGTCCGGTTTAACACAGCCAGTGTCTCCACATCGAGATGAAATGAGA, WBGene00039121
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term