WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00037031 Gene Name  CBG17392
Sequence Name  ? CBG17392 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Fibronectin type III; Immunoglobulin-like fold; Fibronectin type III domain; and Fibronectin type III superfamily. Is an ortholog of C. elegans C34F6.10. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG17392c.1 CBG17392c.1   [unknown]
Transcript:CBG17392a.1 CBG17392a.1   [unknown]
Transcript:CBG17392b.1 CBG17392b.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG17392a CBG17392a   [unknown]
CDS:CBG17392b CBG17392b   [unknown]
CDS:CBG17392c CBG17392c   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00023467

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG17392, AAAGAGACCCTCATATGAAGTGGACACCAAGGATTTCAGCGGAGCTCTCCATGTAAGAGT, WBGene00037031   Expr1067245 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG27532, TCCACATTGAACGACATACATTTGGCATCTAACGACAGTGACAGCAGTACCAGCAGGTAA, WBGene00088946   Expr1064470 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term