WormMine: Gene WBGene00036730

• WormBase Gene ID: WBGene00036730
• Gene Name: CBG16936
• Sequence Name: CBG16936
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Sushi/SCR/CCP domain; Sushi/SCR/CCP superfamily; and Sushi repeat (SCR repeat). Is an ortholog of C. elegans cfh-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

14 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16936b.1	CBG16936b.1		[unknown]
Transcript:CBG16936a.1	CBG16936a.1		[unknown]
Transcript:CBG16936e.1	CBG16936e.1		[unknown]
Transcript:CBG16936d.1	CBG16936d.1		[unknown]
Transcript:CBG16936c.1	CBG16936c.1		[unknown]
Transcript:CBG16936g.1	CBG16936g.1		[unknown]
Transcript:CBG16936f.1	CBG16936f.1		[unknown]
Transcript:CBG16936i.1	CBG16936i.1		[unknown]
Transcript:CBG16936h.1	CBG16936h.1		[unknown]
Transcript:CBG16936k.1	CBG16936k.1		[unknown]
Transcript:CBG16936j.1	CBG16936j.1		[unknown]
Transcript:CBG16936m.1	CBG16936m.1		[unknown]
Transcript:CBG16936l.1	CBG16936l.1		[unknown]
Transcript:CBG16936n.1	CBG16936n.1		[unknown]

Other

14 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16936l	CBG16936l		[unknown]
CDS:CBG16936k	CBG16936k		[unknown]
CDS:CBG16936n	CBG16936n		[unknown]
CDS:CBG16936m	CBG16936m		[unknown]
CDS:CBG16936h	CBG16936h		[unknown]
CDS:CBG16936g	CBG16936g		[unknown]
CDS:CBG16936j	CBG16936j		[unknown]
CDS:CBG16936i	CBG16936i		[unknown]
CDS:CBG16936d	CBG16936d		[unknown]
CDS:CBG16936c	CBG16936c		[unknown]
CDS:CBG16936f	CBG16936f		[unknown]
CDS:CBG16936e	CBG16936e		[unknown]
CDS:CBG16936b	CBG16936b		[unknown]
CDS:CBG16936a	CBG16936a		[unknown]

0 RNAi Result

13 Allele

• WBVar00021722
• WBVar00021692
• WBVar00021727
• WBVar00021697
• WBVar00021732
• WBVar00021702
• WBVar00021737
• WBVar00021707
• WBVar00021742
• WBVar00021712
• WBVar00021747
• WBVar00021717
• WBVar00021687

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

• Primary Identifier: Expr1064496
• Remark: CBG16936, ACGTCGACATGCCAAAACGGCTTGTTCACTGAAATTACAGCTCAGTGTACTAGGATTTGA, WBGene00036730
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1064822
• Remark: CBG16937, CGCGGTTACTGGAATTGCTACTCTACAGTGTCAAAATGGACAATGGGAACCACAAAGTGG, WBGene00036731
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term