WormMine: Gene WBGene00036443

• WormBase Gene ID: WBGene00036443
• Gene Name: Cbr-tmem-131
• Sequence Name: CBG16531
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Transmembrane protein 131-like N-terminal; Transmembrane protein 131-like; and Transmembrane protein 131-like, N-terminal. Is an ortholog of C. elegans tmem-131. In C. elegans, tmem-131 is involved in collagen biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16531a.1	CBG16531a.1		[unknown]
Transcript:CBG16531b.1	CBG16531b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16531a	CBG16531a		[unknown]
CDS:CBG16531b	CBG16531b		[unknown]

0 RNAi Result

1 Allele

• WBVar00021482

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053298
• Remark: CBG16531, TGACGACTACAAATGAAGCAGATCTTCAGCTGTATATGCACATGAATGGTAGCGCGTGGC, WBGene00036443
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term