WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00039814 Gene Name  CBG20910
Sequence Name  ? CBG20910 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Beta-lactamase associated winged helix domain; Metallo-beta-lactamase superfamily; Ribonuclease Z/Hydroxyacylglutathione hydrolase-like; Metallo-beta-lactamase; LACTB2, winged helix domain; and Winged helix-like DNA-binding domain superfamily. Is an ortholog of C. elegans Y53F4B.39. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG20910.1 CBG20910.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG20910 CBG20910   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00029942

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG20911, GTTTCTGTTGCATGTTATGGACGGATGGGATGCTTACGATAATTTGAATTGGTTCGAATC, WBGene00039815   Expr1062400 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG20910, AGAATCTATCCAGGACACGGGCCAGTTATCAATAAAGTCGGGGAGAAGGTTGATGAGTAT, WBGene00039814   Expr1056953 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term