WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00038541 Gene Name  CBG19295
Sequence Name  ? CBG19295 Organism  Caenorhabditis briggsae
Automated Description  Is an ortholog of C. elegans C50F4.8. In C. elegans, C50F4.8 is involved in defense response to Gram-positive bacterium. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG19295.1 CBG19295.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG19295 CBG19295   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00026447
WBVar00026452

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG19295, CGATGTTGTAGCACAGAGCAATCAGGTGTCTGATCATCCAGCTAATCCTAAATTGGTTCA, WBGene00038541   Expr1066289 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term