WormMine: Gene WBGene00025696

• WormBase Gene ID: WBGene00025696
• Gene Name: Cbr-lron-15
• Sequence Name: CBG02687
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Leucine-rich repeat domain superfamily; Leucine-rich repeat; Leucine rich repeat; and Leucine-rich repeat, typical subtype. Is an ortholog of C. elegans lron-15.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02687.1	CBG02687.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02687	CBG02687		[unknown]

0 RNAi Result

13 Allele

• WBVar00107583
• WBVar00107582
• WBVar00107581
• WBVar00107580
• WBVar00107586
• WBVar00107585
• WBVar00107584
• WBVar00107579
• WBVar00107578
• WBVar00107577
• WBVar00107576
• WBVar00107575
• WBVar00107574

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1055325
• Remark: CBG02687, TTCAAAATCAGATGATTTCGATGTCGAGTGTGCAGTCAAGTTCAGTCGACATAACTCCTT, WBGene00025696
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term