WormMine: Gene WBGene00025540

• WormBase Gene ID: WBGene00025540
• Gene Name: Cbr-ifb-1
• Sequence Name: CBG02495
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Lamin tail domain; Intermediate filament, rod domain; Lamin tail domain superfamily; Intermediate filament protein; Intermediate filament, ifa/ifb; and Lamin Tail Domain. Is an ortholog of C. elegans ifb-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02495a.1	CBG02495a.1		[unknown]
Transcript:CBG02495b.1	CBG02495b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02495b	CBG02495b		[unknown]
CDS:CBG02495a	CBG02495a		[unknown]

0 RNAi Result

8 Allele

• WBVar00107402
• WBVar00107401
• WBVar00107400
• WBVar00107396
• WBVar00107395
• WBVar00107399
• WBVar00107398
• WBVar00107397

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_upregulated
	C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_upregulated

2 Expression Patterns

• Primary Identifier: Expr1051474
• Remark: Cbr-ifb-1, AACAAGGATGGAGAGGAACGTGCCACCCACACCCAGAAGACCATCCAATCCGGACAATAA, WBGene00025540
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1057917
• Remark: CBG02494, GTCTCAAAAGGAGTCCTCGGAGTATGAGATTCAATACAGATCCACGATTCAACCGAGAAC, WBGene00025539
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term