WormMine: Gene WBGene00026673

• WormBase Gene ID: WBGene00026673
• Gene Name: CBG03910
• Sequence Name: CBG03910
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Protein-tyrosine phosphatase-like; Myotubularin family; and Myotubularin-like phosphatase domain. Is an ortholog of C. elegans mtm-10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03910.1	CBG03910.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03910	CBG03910		[unknown]

0 RNAi Result

3 Allele

• WBVar00108801
• WBVar00108803
• WBVar00108802

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054975
• Remark: CBG03910, AATTAGATTCAGGATTTGTTGCTCGTATCGGGAAGGCTTTCGATAATCTTTTATCGCTAT, WBGene00026673
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term