WormMine: Gene WBGene00029442

• WormBase Gene ID: WBGene00029442
• Gene Name: Cbr-aakb-1
• Sequence Name: CBG07378
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Association with the SNF1 complex (ASC) domain; 5'-AMP-activated protein kinase beta subunit, interaction domain; Immunoglobulin E-set; AMP-activated protein kinase, glycogen-binding domain; Glycogen recognition site of AMP-activated protein kinase; ASC domain superfamily; and Immunoglobulin-like fold. Is an ortholog of C. elegans aakb-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07378.1	CBG07378.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07378	CBG07378		[unknown]

0 RNAi Result

15 Allele

• WBVar00045509
• WBVar00045504
• WBVar00045519
• WBVar00045514
• WBVar00045529
• WBVar00045524
• WBVar00045534
• WBVar00045494
• WBVar00045489
• WBVar00045499
• WBVar00045474
• WBVar00045464
• WBVar00045469
• WBVar00045484
• WBVar00045479

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067093
• Remark: Cbr-aakb-1, CTATCTATTAAGGATGGAGTGATGGTTCTCTCCGCTACTCATCGCTATCGCAAGAAATTT, WBGene00029442
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term