WormMine: Gene WBGene00034425

• WormBase Gene ID: WBGene00034425
• Gene Name: CBG13700
• Sequence Name: CBG13700
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: Ribonuclease H-like superfamily. Is an ortholog of C. elegans Y105C5A.15.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13700a.1	CBG13700a.1		[unknown]
Transcript:CBG13700c.1	CBG13700c.1		[unknown]
Transcript:CBG13700b.1	CBG13700b.1		[unknown]
Transcript:CBG13700d.1	CBG13700d.1		[unknown]
Transcript:CBG13700e.1	CBG13700e.1		[unknown]

Other

5 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13700c	CBG13700c		[unknown]
CDS:CBG13700d	CBG13700d		[unknown]
CDS:CBG13700a	CBG13700a		[unknown]
CDS:CBG13700b	CBG13700b		[unknown]
CDS:CBG13700e	CBG13700e		[unknown]

0 RNAi Result

9 Allele

• WBVar00046334
• WBVar00046339
• WBVar00046354
• WBVar00046344
• WBVar00046349
• WBVar00046319
• WBVar00046324
• WBVar00046329
• WBVar00015802

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062818
• Remark: CBG13700, GACCCAATTTGATGCACGATGTGCATCAGTAAGCCCAGATCAGCTCCACACATTCCTAAT, WBGene00034425
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term