WormMine: Gene WBGene00029427

• WormBase Gene ID: WBGene00029427
• Gene Name: Cbr-hlb-1
• Sequence Name: CBG07358
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Liprin-beta; LAR-interacting protein, Liprin; Sterile alpha motif domain; SAM domain (Sterile alpha motif); and Sterile alpha motif/pointed domain superfamily. Is an ortholog of C. elegans hlb-1. In C. elegans, hlb-1 is involved in neuromuscular junction development; positive regulation of locomotion; and regulation of nematode pharyngeal pumping.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

9 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07358a.1	CBG07358a.1		[unknown]
Transcript:CBG07358b.1	CBG07358b.1		[unknown]
Transcript:CBG07358e.1	CBG07358e.1		[unknown]
Transcript:CBG07358f.1	CBG07358f.1		[unknown]
Transcript:CBG07358c.1	CBG07358c.1		[unknown]
Transcript:CBG07358d.1	CBG07358d.1		[unknown]
Transcript:CBG07358i.1	CBG07358i.1		[unknown]
Transcript:CBG07358g.1	CBG07358g.1		[unknown]
Transcript:CBG07358h.1	CBG07358h.1		[unknown]

Other

9 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07358g	CBG07358g		[unknown]
CDS:CBG07358h	CBG07358h		[unknown]
CDS:CBG07358i	CBG07358i		[unknown]
CDS:CBG07358c	CBG07358c		[unknown]
CDS:CBG07358d	CBG07358d		[unknown]
CDS:CBG07358e	CBG07358e		[unknown]
CDS:CBG07358f	CBG07358f		[unknown]
CDS:CBG07358a	CBG07358a		[unknown]
CDS:CBG07358b	CBG07358b		[unknown]

0 RNAi Result

4 Allele

• WBVar00007417
• WBVar00112221
• WBVar00112220
• WBVar00016274

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

• Primary Identifier: Expr1058684
• Remark: CBG07357, TTTTCAACCCACCAAGGATCTATCAGGAATTTGTGAAGGCTATCGACGAGCACACAATGA, WBGene00029426
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1052664
• Remark: Cbr-hlb-1, GCCAGAAGATCATTGCCGATAAGCGGGATTTCCTGGCTGCCGGCAACTATCCGCAAATCT, WBGene00029427
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term