WormMine: Gene WBGene00027708

• WormBase Gene ID: WBGene00027708
• Gene Name: Cbr-lon-1
• Sequence Name: CBG05195
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: CAP domain; Cysteine-rich secretory protein-related; CAP superfamily; and Cysteine-rich secretory protein family. Is an ortholog of C. elegans lon-1. In C. elegans, lon-1 is involved in several processes, including negative regulation of BMP signaling pathway; negative regulation of DNA endoreduplication; and positive regulation of growth rate.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05195b.1	CBG05195b.1		[unknown]
Transcript:CBG05195a.1	CBG05195a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05195b	CBG05195b		[unknown]
CDS:CBG05195a	CBG05195a		[unknown]

0 RNAi Result

7 Allele

• WBVar00110090
• WBVar00110091
• WBVar00110094
• WBVar00110095
• WBVar00110092
• WBVar00110093
• WBVar00110096

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050734
• Remark: Cbr-lon-1, GATGCTCAAACTGTCCAGCAAATGCTCCAGCCTGTTATCAAGGTCTCTGTTATATGCCAA, WBGene00027708
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term