WormMine: Gene WBGene00033309

• WormBase Gene ID: WBGene00033309
• Gene Name: Cbr-cle-1
• Sequence Name: CBG12347
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: C-type lectin-like/link domain superfamily; Collagenase NC10/endostatin; Collagenase NC10 and Endostatin; Laminin G domain; Concanavalin A-like lectin/glucanase domain superfamily; Collagen triple helix repeat; Collagen triple helix repeat (20 copies); and C-type lectin fold. Is an ortholog of C. elegans cle-1. In C. elegans, cle-1 is involved in several processes, including cholinergic synaptic transmission; generation of neurons; and inductive cell migration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

11 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12347g.1	CBG12347g.1		[unknown]
Transcript:CBG12347h.1	CBG12347h.1		[unknown]
Transcript:CBG12347e.1	CBG12347e.1		[unknown]
Transcript:CBG12347f.1	CBG12347f.1		[unknown]
Transcript:CBG12347k.1	CBG12347k.1		[unknown]
Transcript:CBG12347i.1	CBG12347i.1		[unknown]
Transcript:CBG12347j.1	CBG12347j.1		[unknown]
Transcript:CBG12347c.1	CBG12347c.1		[unknown]
Transcript:CBG12347d.1	CBG12347d.1		[unknown]
Transcript:CBG12347a.1	CBG12347a.1		[unknown]
Transcript:CBG12347b.1	CBG12347b.1		[unknown]

Other

11 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12347c	CBG12347c		[unknown]
CDS:CBG12347d	CBG12347d		[unknown]
CDS:CBG12347a	CBG12347a		[unknown]
CDS:CBG12347b	CBG12347b		[unknown]
CDS:CBG12347g	CBG12347g		[unknown]
CDS:CBG12347h	CBG12347h		[unknown]
CDS:CBG12347e	CBG12347e		[unknown]
CDS:CBG12347f	CBG12347f		[unknown]
CDS:CBG12347k	CBG12347k		[unknown]
CDS:CBG12347i	CBG12347i		[unknown]
CDS:CBG12347j	CBG12347j		[unknown]

0 RNAi Result

1 Allele

• WBVar00008914

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055140
• Remark: Cbr-cle-1, CATGTCCAAATATCACAGCGATCGAATTCTCCGTCTCAACAGAATCACCACCGACTTCAA, WBGene00033309
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term