WormMine: Gene WBGene00029813

• WormBase Gene ID: WBGene00029813
• Gene Name: Cbr-smu-1
• Sequence Name: CBG07923
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: G-protein beta WD-40 repeat; LIS1 homology motif; WD40-repeat-containing domain superfamily; CTLH, C-terminal LisH motif; WD40/YVTN repeat-like-containing domain superfamily; WD domain, G-beta repeat; WD40 repeat; and LisH-like dimerisation domain. Is an ortholog of C. elegans smu-1. In C. elegans, smu-1 is involved in several processes, including mechanosensory behavior; nematode larval development; and regulation of alternative mRNA splicing, via spliceosome.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07923.1	CBG07923.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07923	CBG07923		[unknown]

0 RNAi Result

14 Allele

• WBVar00009442
• WBVar00009447
• WBVar00009432
• WBVar00009437
• WBVar00009482
• WBVar00009487
• WBVar00009472
• WBVar00009477
• WBVar00009462
• WBVar00009467
• WBVar00009452
• WBVar00009457
• WBVar00009492
• WBVar00009497

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064737
• Remark: Cbr-smu-1, CATTCCAAAAAGCGACCCACCCCAAATGGTGGTCTGTAATCGCTCGAATACGCTTTATGT, WBGene00029813
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term