WormMine: Gene WBGene00030484

• WormBase Gene ID: WBGene00030484
• Gene Name: Cbr-lev-10
• Sequence Name: CBG08746
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Low-density lipoprotein (LDL) receptor class A repeat; CUB domain; and Spermadhesin, CUB domain superfamily. Is an ortholog of C. elegans lev-10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08746b.1	CBG08746b.1		[unknown]
Transcript:CBG08746a.1	CBG08746a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08746b	CBG08746b		[unknown]
CDS:CBG08746a	CBG08746a		[unknown]

0 RNAi Result

3 Allele

• WBVar00113968
• WBVar00113969
• WBVar00113970

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050509
• Remark: Cbr-eat-18, TGAGATGTAATGGATTGGATAATTGTGGATATGGAGTACAAGATGATACCGATGAGCAGC, WBGene00030484
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term