WormMine: Gene WBGene00030164

• WormBase Gene ID: WBGene00030164
• Gene Name: Cbr-acs-4
• Sequence Name: CBG08359
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: AMP-binding enzyme, C-terminal domain; AMP-binding enzyme; AMP-dependent synthetase/ligase; and AMP-binding enzyme C-terminal domain. Is an ortholog of C. elegans acs-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08359.1	CBG08359.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08359	CBG08359		[unknown]

0 RNAi Result

1 Allele

• WBVar00113524

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly decreased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_downregulated

1 Expression Patterns

• Primary Identifier: Expr1067296
• Remark: CBG08359, GTAAACTATCGCGCACCGAAATTCCTGCTGCAATCCATCTTTGTCCCGATATCTGGACAC, WBGene00030164
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term