WormMine: Gene WBGene00031917

• WormBase Gene ID: WBGene00031917
• Gene Name: Cbr-prmt-6
• Sequence Name: CBG10553
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: S-adenosyl-L-methionine-dependent methyltransferase; Methyltransferase domain 25; and Methyltransferase domain. Is an ortholog of C. elegans prmt-6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10553.1	CBG10553.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10553	CBG10553		[unknown]

0 RNAi Result

16 Allele

• WBVar00115945
• WBVar00115946
• WBVar00115947
• WBVar00115948
• WBVar00115941
• WBVar00115942
• WBVar00115943
• WBVar00115944
• WBVar00115949
• WBVar00115950
• WBVar00115951
• WBVar00115939
• WBVar00115940
• WBVar00115952
• WBVar00115953
• WBVar00115954

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054623
• Remark: Cbr-prmt-6, TAGAAGGCGTCAACCCTCCAGAAGACATGGGATGGAAATTGGGGGCTCAGATTCAAAAGA, WBGene00031917
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term