WormMine: Gene WBGene00032404

• WormBase Gene ID: WBGene00032404
• Gene Name: Cbr-lmd-3
• Sequence Name: CBG11250
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: TLD; LysM domain; LysM domain superfamily; and TLDc domain. Is an ortholog of C. elegans lmd-3. In C. elegans, lmd-3 is involved in determination of adult lifespan; response to heat; and response to oxidative stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11250c.1	CBG11250c.1		[unknown]
Transcript:CBG11250a.1	CBG11250a.1		[unknown]
Transcript:CBG11250b.1	CBG11250b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11250c	CBG11250c		[unknown]
CDS:CBG11250b	CBG11250b		[unknown]
CDS:CBG11250a	CBG11250a		[unknown]

0 RNAi Result

29 Allele

• WBVar00116726
• WBVar00116727
• WBVar00116728
• WBVar00116729
• WBVar00116722
• WBVar00116723
• WBVar00116724
• WBVar00116725
• WBVar00116730
• WBVar00116731
• WBVar00116732
• WBVar00116715
• WBVar00116716
• WBVar00116717
• WBVar00116718
• WBVar00116711
• WBVar00116712
• WBVar00116713
• WBVar00116714
• WBVar00116719
• WBVar00116720
• WBVar00116721
• WBVar00116704
• WBVar00116705
• WBVar00116706
• WBVar00116707
• WBVar00116708
• WBVar00116709
• WBVar00116710

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

• Primary Identifier: Expr1060067
• Remark: CBG11251, TCAAGAAGAAGGCGGCGAAGCCGATGAGAACAAGATCCAAGTCACTAGGAGCACCGTATG, WBGene00032405
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1056890
• Remark: CBG11250, GAGAGGCCAAGGAGTTTTTCGGAACTGGATACGCCATCAGAAGGCAAGAATATCGGAAGG, WBGene00032404
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term