WormMine: Gene WBGene00032739

• WormBase Gene ID: WBGene00032739
• Gene Name: Cbr-eor-1
• Sequence Name: CBG11647
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, C2H2 type; C2H2-type zinc-finger domain; BTB/POZ domain; Zinc finger C2H2-type; SKP1/BTB/POZ domain superfamily; BTB/Kelch-associated; BTB And C-terminal Kelch; and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans eor-1. In C. elegans, eor-1 is involved in several processes, including determination of adult lifespan; nematode male tail tip morphogenesis; and signal transduction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11647.1	CBG11647.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11647	CBG11647		[unknown]

0 RNAi Result

4 Allele

• WBVar00117270
• WBVar00013377
• WBVar00013382
• WBVar00013372

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059278
• Remark: Cbr-eor-1, ATCTCTGTAAAATCTGTGGTCGTGGATTCATCGAAAAGTCTCATCTAGTTCGACACGAAA, WBGene00032739
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term