WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00033531 Gene Name  Cbr-gld-2
Sequence Name  ? CBG12609 Organism  Caenorhabditis briggsae
Automated Description  Is affected by Cbr-htz-1 and Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domains: Cid1 family poly A polymerase; TUTase nucleotidyltransferase domain; Nucleotidyltransferase superfamily; and PAP/25A-associated. Is an ortholog of C. elegans gld-2. In C. elegans, gld-2 is involved in several processes, including cytosolic mRNA polyadenylation; positive regulation of meiosis I; and regulation of cell division. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG12609c.1 CBG12609c.1   [unknown]
Transcript:CBG12609b.1 CBG12609b.1   [unknown]
Transcript:CBG12609a.1 CBG12609a.1   [unknown]
Transcript:CBG12609d.1 CBG12609d.1   [unknown]
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG12609a CBG12609a   [unknown]
CDS:CBG12609d CBG12609d   [unknown]
CDS:CBG12609c CBG12609c   [unknown]
CDS:CBG12609b CBG12609b   [unknown]

0 RNAi Result

6 Allele

Public Name
WBVar00118698
WBVar00118695
WBVar00118694
WBVar00118697
WBVar00118696
WBVar00014622

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-htz-1(gu167)_upregulated
  Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-spr-4(gu163)_upregulated

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG12607, AACAACAACATCATGAAGCGAAAATCCATCAATATAGATCTGCGGGGACTGCTCCTGGGG, WBGene00033529   Expr1060876 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG12608, CGATTTAACAATGAATCGGAACAAAAACTGGTAGCTCCTGCGAAGTTTCCCTTGTGTTGG, WBGene00033530   Expr1062234 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cbr-gld-2, TATTCGGCGCCATCAAAGAAGCTTTCCGTGAGGCTCATAGCGAGTTACAAGACAATCGAG, WBGene00033531   Expr1050959 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term