WormMine: Gene WBGene00034157

• WormBase Gene ID: WBGene00034157
• Gene Name: Cbr-lov-1
• Sequence Name: CBG13381
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: PLAT/LH2 domain; Polycystin cation channel, PKD1/PKD2; GPS motif; Polycystin cation channel; and PLAT/LH2 domain superfamily. Is an ortholog of C. elegans lov-1. In C. elegans, lov-1 is involved in response to hermaphrodite contact and vulval location.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13381b.1	CBG13381b.1		[unknown]
Transcript:CBG13381a.1	CBG13381a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13381b	CBG13381b		[unknown]
CDS:CBG13381a	CBG13381a		[unknown]

0 RNAi Result

13 Allele

• WBVar00119671
• WBVar00119672
• WBVar00119670
• WBVar00119675
• WBVar00119673
• WBVar00119674
• WBVar00119668
• WBVar00119669
• WBVar00119666
• WBVar00119667
• WBVar00119664
• WBVar00119665
• WBVar00119663

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055273
• Remark: Cbr-lov-1, TTACCTGAACGATAAGGTATCCAGAAGTATGGGGATAGGAACGGTACGACAAGTGAGAAC, WBGene00034157
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term