WormMine: Gene WBGene00038612

• WormBase Gene ID: WBGene00038612
• Gene Name: Cbr-sru-38
• Sequence Name: CBG19377
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: 7TM GPCR, serpentine receptor class u (Sru) and Serpentine type 7TM GPCR chemoreceptor Sru. Is an ortholog of C. elegans sru-38.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19377.1	CBG19377.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19377	CBG19377		[unknown]

0 RNAi Result

24 Allele

• WBVar00057359
• WBVar00057364
• WBVar00057344
• WBVar00057349
• WBVar00057354
• WBVar00057369
• WBVar00057374
• WBVar00057319
• WBVar00057314
• WBVar00057309
• WBVar00057304
• WBVar00057334
• WBVar00057339
• WBVar00057324
• WBVar00057329
• WBVar00057284
• WBVar00057289
• WBVar00057294
• WBVar00057299
• WBVar00127413
• WBVar00127412
• WBVar00127416
• WBVar00127415
• WBVar00127414

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067202
• Remark: Cbr-sru-38, GTGAACATCGTCTCCTGTTACTTCTACTTGACTCATCCAATTTTCAAACAAGAACCGAAC, WBGene00038612
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term