WormMine: Gene WBGene00303154

• WormBase Gene ID: WBGene00303154
• Gene Name: CBG31221
• Sequence Name: CBG31221
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Cytochrome b5-like Heme/Steroid binding domain; Cytochrome b5-like heme/steroid binding domain superfamily; and Cytochrome b5-like heme/steroid binding domain.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG31221.1	CBG31221.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG31221	CBG31221		[unknown]

0 RNAi Result

1 Allele

• WBVar00027119

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059415
• Remark: CBG23264, AAAGTTCAAGATTGGATCTCTCCCAGAAGAGGAGCGTCCAGACTTCGTTCAAGCTGAATA, WBGene00041650
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term