WormMine: Gene WBGene00033987

• WormBase Gene ID: WBGene00033987
• Gene Name: Cbr-tra-1
• Sequence Name: CBG13188
• Brief Description: Cbr-tra-1 encodes a Gli/Ci-related zinc-finger transcription factor that is orthologous to C. elegans TRA-1; like in C. elegans, mutations in Cbr-tra-1 result in sexual cell fate transformations of XX hermaphrodites to male fates such as one-armed gonads, masculinized tails, and varying degrees of male mating behavior.
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, C2H2 type; Zinc finger C2H2 superfamily; and Zinc finger C2H2-type. Is an ortholog of C. elegans tra-1. In C. elegans, tra-1 is involved in developmental process involved in reproduction; negative regulation of transcription by RNA polymerase II; and positive regulation of neuron apoptotic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13188b.1	CBG13188b.1		[unknown]
Transcript:CBG13188a.1	CBG13188a.1		[unknown]
Transcript:CBG13188c.1	CBG13188c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13188c	CBG13188c		[unknown]
CDS:CBG13188b	CBG13188b		[unknown]
CDS:CBG13188a	CBG13188a		[unknown]

0 RNAi Result

4 Allele

• nm30
• nm10
• nm2
• nm1

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051404
• Remark: Cbr-tra-1, CCTCCCTTCGCAAGCACATCAAAGCAGTTCATGGAGACGAGGAGTACGAGAAGGCAAAGA, WBGene00033987
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term