WormMine: Gene WBGene00035296

• WormBase Gene ID: WBGene00035296
• Gene Name: Cbr-wdr-12
• Sequence Name: CBG14922
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domains: WD40-repeat-containing domain superfamily; WD40/YVTN repeat-like-containing domain superfamily; WD domain, G-beta repeat; WD40 repeat; NLE; and NLE (NUC135) domain. Is an ortholog of C. elegans wdr-12.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14922.1	CBG14922.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14922	CBG14922		[unknown]

0 RNAi Result

7 Allele

• WBVar00121870
• WBVar00121871
• WBVar00121872
• WBVar00121873
• WBVar00121874
• WBVar00121875
• WBVar00121869

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1053976
• Remark: Cbr-tag-345, CGAAATCATTCACCAGTATCGACATTCATCCAACAAGTAACCTTCTGATCTCCAGTTGCA, WBGene00035296
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term