Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG14922.1 | CBG14922.1 | [unknown] |
Other
7 Allele
Public Name |
---|
WBVar00121870 |
WBVar00121871 |
WBVar00121872 |
WBVar00121873 |
WBVar00121874 |
WBVar00121875 |
WBVar00121869 |
1 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_downregulated |
1 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
Cbr-tag-345, CGAAATCATTCACCAGTATCGACATTCATCCAACAAGTAACCTTCTGATCTCCAGTTGCA, WBGene00035296 | Expr1053976 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |