WormMine: Gene WBGene00035052

• WormBase Gene ID: WBGene00035052
• Gene Name: Cbr-tbc-7
• Sequence Name: CBG14616
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domains: TLD; Rab-GTPase-TBC domain superfamily; Rab-GTPase-TBC domain; and TLDc domain. Is an ortholog of C. elegans tbc-7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14616a.2	CBG14616a.2		[unknown]
Transcript:CBG14616a.1	CBG14616a.1		[unknown]
Transcript:CBG14616b.1	CBG14616b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14616b	CBG14616b		[unknown]
CDS:CBG14616a	CBG14616a		[unknown]

0 RNAi Result

10 Allele

• WBVar00121562
• WBVar00121563
• WBVar00121560
• WBVar00121561
• WBVar00121554
• WBVar00121555
• WBVar00121556
• WBVar00121557
• WBVar00121558
• WBVar00121559

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1050582
• Remark: CBG14616, GACGGGACCAAGCACCACATTCAACAGCCCGCAGCTTTGCGAGGAAGGAGCATTTGATAT, WBGene00035052
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term