WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00036497 Gene Name  Cbr-ogt-1
Sequence Name  ? CBG16605 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Tetratricopeptide repeat 1; Tetratricopeptide repeat; O-GlcNAc transferase, C-terminal; Tetratricopeptide-like helical domain superfamily; UDP-N-acetylglucosamine--peptide N-acetylglucosaminyltransferase 110kDa subunit; Glycosyl transferase family 41; and TPR repeat. Is an ortholog of C. elegans ogt-1. In C. elegans, ogt-1 is involved in several processes, including dauer larval development; glycogen metabolic process; and lipid storage. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG16605a.1 CBG16605a.1   [unknown]
Transcript:CBG16605b.1 CBG16605b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG16605b CBG16605b   [unknown]
CDS:CBG16605a CBG16605a   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00124170
WBVar00124171

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-ogt-1, AACAATATTGTCATGACATGGAAGACCTTCTGGAGCTAATGTGGAAACGTTACGAGAACG, WBGene00036497   Expr1061560 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term