WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00122825 Gene Name  CJA03621
Sequence Name  ? CJA03621 Organism  Caenorhabditis japonica
Automated Description  Is an ortholog of C. elegans unc-44. In C. elegans, unc-44 is involved in several processes, including axon guidance; establishment or maintenance of cytoskeleton polarity; and regulation of cellular component organization. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA03621.1 CJA03621.1   [unknown]
Transcript:CJA03621.2 CJA03621.2   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA03621 CJA03621   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA03621, GATACGGAGGGAAACGTGACCAGAACCACGTTCCGACGTGAGCAAGAACATCATTATTAA, WBGene00122825   Expr1071448 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term