WormMine: Gene WBGene00130514

• WormBase Gene ID: WBGene00130514
• Gene Name: Cjp-cest-24
• Sequence Name: CJA11310
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Carboxylesterase family; Carboxylesterase, type B; and Alpha/Beta hydrolase fold. Is an ortholog of C. elegans cest-24.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA11310b.1	CJA11310b.1		[unknown]
Transcript:CJA11310a.1	CJA11310a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA11310a	CJA11310a		[unknown]
CDS:CJA11310b	CJA11310b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078085
• Remark: CJA11310, TGTACGAAGAGCATTTGGGTGTGATGTACGACGAGTCACGCTCAATGTTTTTGCAAAAAG, WBGene00130514
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term