WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00135938 Gene Name  CJA16735
Sequence Name  ? CJA16735 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: FAD dependent oxidoreductase; Glycine cleavage T-protein C-terminal barrel domain; GTP-binding protein TrmE/Aminomethyltransferase GcvT, domain 1; Aminomethyltransferase folate-binding domain; FAD dependent oxidoreductase central domain; Glycine cleavage T-protein/YgfZ, C-terminal; Aminomethyltransferase, folate-binding domain; FAD dependent oxidoreductase, central domain; Glycine cleavage T-protein, C-terminal barrel domain; and FAD/NAD(P)-binding domain superfamily. Is an ortholog of C. elegans Y37E3.17. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA16735b.1 CJA16735b.1   [unknown]
Transcript:CJA16735a.1 CJA16735a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA16735a CJA16735a   [unknown]
CDS:CJA16735b CJA16735b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA22958, GAGTTGCGGGAAGTTCAGTCGCGTATCATTTGACGAAGCGCAATATCAAGGATGTGCTGC, WBGene00178530   Expr1087071 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA16735, GACAGATATGTGCCAAGTGGAAACGAGGTCATCAGAATCGATGGACAAGAGGCGAGAGTC, WBGene00135938   Expr1090703 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term