WormMine: Gene WBGene00215615

• WormBase Gene ID: WBGene00215615
• Gene Name: CJA39768
• Sequence Name: CJA39768
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Glucosidase II beta subunit-like; Glucosidase 2 subunit beta; Glucosidase II beta subunit-like protein; Mannose-6-phosphate receptor binding domain superfamily; and Glucosidase 2 subunit beta-like. Is an ortholog of C. elegans ZK1307.8. In C. elegans, ZK1307.8 is involved in PERK-mediated unfolded protein response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA39768.1	CJA39768.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA39768	CJA39768		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1075540
• Remark: CJA14087, TTCTGTCCATTCGGACAAAATACGCAAAAAGACACTGGAGCGTACAGTGGAACCTCACTG, WBGene00133291
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term