WormMine: Gene WBGene00128832

• WormBase Gene ID: WBGene00128832
• Gene Name: Cjp-fbxa-141
• Sequence Name: CJA09627
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: F-box domain; F-box A protein FB155/FB224; FTH domain; and Domain of unknown function DUF38, Caenorhabditis species. Is an ortholog of C. elegans fbxa-141.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09627a.1	CJA09627a.1		[unknown]
Transcript:CJA09627b.1	CJA09627b.1		[unknown]
Transcript:CJA09627c.1	CJA09627c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09627a	CJA09627a		[unknown]
CDS:CJA09627c	CJA09627c		[unknown]
CDS:CJA09627b	CJA09627b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1084960
• Remark: Cjp-fbxa-141, TTTCTATTGCTGAATTTCTTCATTCGAAAACATTTTGGACTGTTGTGCCGAAATTGGAGC, WBGene00128832
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term