WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00129199 Gene Name  CJA09995
Sequence Name  ? CJA09995 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Electron transfer DM13 and DM13 domain. Is an ortholog of C. elegans W01C8.5. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA09995a.1 CJA09995a.1   [unknown]
Transcript:CJA09995b.1 CJA09995b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA09995b CJA09995b   [unknown]
CDS:CJA09995a CJA09995a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA09995, CGTTCAACCGGGAAAAGTGGCACACTTTGGCGTTGAGCAGACAGAGAGCCGATAAAGTTA, WBGene00129199   Expr1071026 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term