WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00120092 Gene Name  Cjp-ran-3
Sequence Name  ? CJA00888 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Regulator of chromosome condensation (RCC1) repeat; Regulator of chromosome condensation, RCC1; and Regulator of chromosome condensation 1/beta-lactamase-inhibitor protein II. Is an ortholog of C. elegans ran-3. In C. elegans, ran-3 is involved in embryo development and positive regulation of nematode male tail tip morphogenesis. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA00888.1 CJA00888.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA00888 CJA00888   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-ran-3, TTTTCCATTATCGGAGCCTCTATTTCCGATCAGCACACTCTAATCCTGGCCAAAAAGAAC, WBGene00120092   Expr1089740 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term