WormMine: Gene WBGene00068821

• WormBase Gene ID: WBGene00068821
• Gene Name: Cre-morc-1.2
• Sequence Name: CRE06125
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Histidine kinase/HSP90-like ATPase superfamily; Morc, S5 domain 2-like; Morc6 ribosomal protein S5 domain 2-like; and Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase. Is an ortholog of C. elegans morc-1. In C. elegans, morc-1 is involved in DNA topological change.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE06125.1	CRE06125.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE06125	CRE06125		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1111441
• Remark: CRE06125, AAAGAGCATCTGGACAACTACAACCAATTCCTCGTCTGGTTCAATACAACACCCATCTCA, WBGene00068821
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term