WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00035450 Gene Name  Cbr-dpy-1
Sequence Name  ? CBG15118 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: von Willebrand factor, type A; Zona pellucida domain; von Willebrand factor type A domain; and von Willebrand factor A-like domain superfamily. Is an ortholog of C. elegans dpy-1. In C. elegans, dpy-1 is involved in body morphogenesis and regulation of growth. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

12 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG15118b.1 CBG15118b.1   [unknown]
Transcript:CBG15118a.1 CBG15118a.1   [unknown]
Transcript:CBG15118d.1 CBG15118d.1   [unknown]
Transcript:CBG15118c.1 CBG15118c.1   [unknown]
Transcript:CBG15118f.1 CBG15118f.1   [unknown]
Transcript:CBG15118e.1 CBG15118e.1   [unknown]
Transcript:CBG15118h.1 CBG15118h.1   [unknown]
Transcript:CBG15118g.1 CBG15118g.1   [unknown]
Transcript:CBG15118j.1 CBG15118j.1   [unknown]
Transcript:CBG15118k.1 CBG15118k.1   [unknown]
Transcript:CBG15118i.1 CBG15118i.1   [unknown]
Transcript:CBG15118l.1 CBG15118l.1   [unknown]
 

Other

12 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG15118g CBG15118g   [unknown]
CDS:CBG15118f CBG15118f   [unknown]
CDS:CBG15118e CBG15118e   [unknown]
CDS:CBG15118d CBG15118d   [unknown]
CDS:CBG15118k CBG15118k   [unknown]
CDS:CBG15118j CBG15118j   [unknown]
CDS:CBG15118i CBG15118i   [unknown]
CDS:CBG15118h CBG15118h   [unknown]
CDS:CBG15118c CBG15118c   [unknown]
CDS:CBG15118b CBG15118b   [unknown]
CDS:CBG15118a CBG15118a   [unknown]
CDS:CBG15118l CBG15118l   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-dpy-1, CTCCTCAACCCAACCCGCGACTAGCAGATTTTATGCGAAATTTTGATAGAAATCGATATG, WBGene00035450   Expr1066974 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term