WormMine: Gene WBGene00052564

• WormBase Gene ID: WBGene00052564
• Gene Name: Cre-sel-1
• Sequence Name: CRE27129
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Sel1 repeat; Tetratricopeptide-like helical domain superfamily; and Sel1-like repeat. Is an ortholog of C. elegans sel-1. In C. elegans, sel-1 is involved in negative regulation of Notch signaling pathway.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE27129.1	CRE27129.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE27129	CRE27129		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1105372
• Remark: Cre-sel-1, AAAGATTCTACGATCAAGCGATAGAGCACAGTCAAGATGCGTACATGCCGGCGAAGCTGG, WBGene00052564
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term