WormMine: Gene WBGene00037526

• WormBase Gene ID: WBGene00037526
• Gene Name: Cbr-sel-2
• Sequence Name: CBG18029
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: BEACH domain superfamily; Armadillo-type fold; BEACH domain; Neurobeachin/BDCP, DUF4704; PH-BEACH domain; WD40-repeat-containing domain superfamily; WD domain, G-beta repeat; WD40 repeat; Neurobeachin-like, DUF1088; Concanavalin A-like lectin/glucanase domain superfamily; Concanavalin A-like lectin/glucanases superfamily; Neurobeachin/BDCP, DUF4704 alpha solenoid region; PH domain associated with Beige/BEACH; and Beige/BEACH domain. Is an ortholog of C. elegans sel-2. In C. elegans, sel-2 is involved in several processes, including apical protein localization; negative regulation of Notch signaling pathway; and regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18029a.1	CBG18029a.1		[unknown]
Transcript:CBG18029b.1	CBG18029b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18029a	CBG18029a		[unknown]
CDS:CBG18029b	CBG18029b		[unknown]

0 RNAi Result

3 Allele

• WBVar00025229
• WBVar00025219
• WBVar00025224

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070040
• Remark: Cbr-sel-2, AGATTTCCGTGGTTATCTGCAGAAGACACTGGTTGGCACACATGGACAAGAAATCATGAA, WBGene00037526
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term