WormMine: Gene WBGene00126284

• WormBase Gene ID: WBGene00126284
• Gene Name: CJA07080
• Sequence Name: CJA07080
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Electron transfer DM13 and DM13 domain. Is an ortholog of C. elegans H06A10.1. In C. elegans, H06A10.1 is involved in nematode larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07080.1	CJA07080.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07080	CJA07080		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1082866
• Remark: CJA07080, GATAATACGACTTGCTGAAAATCAGACAATTTATGATATTGAATGGCTCAGTGTGTTCTG, WBGene00126284
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term