WormMine: Gene WBGene00071035

• WormBase Gene ID: WBGene00071035
• Gene Name: Cre-slx-1
• Sequence Name: CRE20035
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, RING/FYVE/PHD-type; GIY-YIG endonuclease; GIY-YIG endonuclease superfamily; and GIY-YIG catalytic domain. Is an ortholog of C. elegans slx-1. In C. elegans, slx-1 is involved in several processes, including DNA metabolic process; meiotic chromosome separation; and regulation of multicellular organismal development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE20035.1	CRE20035.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE20035	CRE20035		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1117411
• Remark: Cre-slx-1, CCCTTCGGTTCGAGTGGGCGTGGCAGAATCCTACAGTATCCAAGACTCTAAAAGAGAAAA, WBGene00071035
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term