WormMine: Gene WBGene00027066

• WormBase Gene ID: WBGene00027066
• Gene Name: Cbr-ego-2
• Sequence Name: CBG04380
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: BRO1 domain superfamily; ALIX V-shaped domain; ALIX V-shaped domain binding to HIV; BRO1-like domain; and BRO1 domain. Is an ortholog of C. elegans ego-2. In C. elegans, ego-2 is involved in positive regulation of Notch signaling pathway and protein localization to basolateral plasma membrane.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04380a.1	CBG04380a.1		[unknown]
Transcript:CBG04380b.1	CBG04380b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04380b	CBG04380b		[unknown]
CDS:CBG04380a	CBG04380a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057142
• Remark: Cbr-ego-2, CACCACCACTCAACCCATCCGACCCACTGAATCAAATCGACGCATTCGGCAGTTTTAAAT, WBGene00027066
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term