WormMine: Gene WBGene00040899

• WormBase Gene ID: WBGene00040899
• Gene Name: Cbr-smo-1
• Sequence Name: CBG22301
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Ubiquitin-like domain superfamily; Rad60/SUMO-like domain; Ubiquitin-2 like Rad60 SUMO-like; and Ubiquitin-like domain. Is an ortholog of C. elegans smo-1. In C. elegans, smo-1 is involved in several processes, including chromosome organization; multicellular organismal locomotion; and muscle cell cellular homeostasis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22301.1	CBG22301.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22301	CBG22301		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly decreased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_downregulated

1 Expression Patterns

• Primary Identifier: Expr1057448
• Remark: CBG15104, AAGACACTCCAAAGTCGCTCGAGATGGAGGACGACGATGTTATCGAGGTGTACCAAGAGC, WBGene00035440
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term