WormMine: Gene WBGene00038439

• WormBase Gene ID: WBGene00038439
• Gene Name: CBG19173
• Sequence Name: CBG19173
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Trypsin Inhibitor like cysteine rich domain; Serine protease inhibitor-like superfamily; and Trypsin Inhibitor-like, cysteine rich domain. Is an ortholog of C. elegans swm-1. In C. elegans, swm-1 is involved in spermatid development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19173.1	CBG19173.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19173	CBG19173		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064108
• Remark: CBG19173, GGTTCAGCCTGTGAGCCAAGTTGTGCCAACCCAAATCCAGAAATCTGTACTGAGCAATGC, WBGene00038439
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term