WormMine: Gene WBGene00072836

• WormBase Gene ID: WBGene00072836
• Gene Name: Cre-rege-1
• Sequence Name: CRE06182
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Ribonuclease Zc3h12a-like, NYN domain; Rege-1, UBA-like domain; UBA-like domain; Endoribonuclease Regnase 1/ ZC3H12 C-terminal domain; Endoribonuclease Regnase 1/ZC3H12, C-terminal domain; and Zc3h12a-like Ribonuclease NYN domain. Is an ortholog of C. elegans rege-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE06182.1	CRE06182.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE06182	CRE06182		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1098806
• Remark: CRE06182, GAATCGAAAGTTTCCTCTCAAAAGTGCCAGTCGTCTCATCAAACCCACTGATTTGTCCAT, WBGene00072836
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term