WormMine: Gene WBGene00120467

• WormBase Gene ID: WBGene00120467
• Gene Name: Cjp-igcm-1
• Sequence Name: CJA01263
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Immunoglobulin I-set domain; Immunoglobulin I-set; Immunoglobulin subtype; Fibronectin type III; Immunoglobulin-like domain; Immunoglobulin V-set domain; Immunoglobulin-like fold; Immunoglobulin domain; CD80-like C2-set immunoglobulin domain; CD80-like, immunoglobulin C2-set; Immunoglobulin subtype 2; Immunoglobulin-like domain superfamily; and Fibronectin type III superfamily. Is an ortholog of C. elegans igcm-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA01263a.1	CJA01263a.1		[unknown]
Transcript:CJA01263b.1	CJA01263b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA01263b	CJA01263b		[unknown]
CDS:CJA01263a	CJA01263a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1083878
• Remark: CJA01263, TCGAATGAGCCTATTTCCAATGTTCCTAATGGAAGAAAATACAAAGCCAGGTTCTGTTTG, WBGene00120467
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term