WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00040122 Gene Name  CBG21312
Sequence Name  ? CBG21312 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: G-protein beta WD-40 repeat; Histone-binding protein RBBP4, N-terminal; WD40/YVTN repeat-like-containing domain superfamily; Histone-binding protein RBBP4 or subunit C of CAF1 complex; WD40 repeat; WD domain, G-beta repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans Y54H5A.1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG21312.1 CBG21312.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG21312 CBG21312   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG21312, GGGTCAGAAAGAGGTCAAAGAGGTTCATTGGCATCCACAGATTCCTGGATTGGCTATCAA, WBGene00040122   Expr1050298 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term