WormMine: Gene WBGene00040687

• WormBase Gene ID: WBGene00040687
• Gene Name: Cbr-moag-4
• Sequence Name: CBG22046
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Uncharacterised protein family SERF, N-terminal and 4F5 protein related disordered region. Is an ortholog of C. elegans moag-4. In C. elegans, moag-4 is involved in protein destabilization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22046.1	CBG22046.1		[unknown]
Transcript:CBG22046.2	CBG22046.2		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22046	CBG22046		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063824
• Remark: CBG22046, AGCCGCCGCCGCATCGGCAAACGCCAAAAAAGTCGCCAAAGTGGACCCATTGAAAATGTG, WBGene00040687
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term