WormMine: Gene WBGene00040565

• WormBase Gene ID: WBGene00040565
• Gene Name: CBG21893
• Sequence Name: CBG21893
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Glycosyltransferase 2-like; Nucleotide-diphospho-sugar transferases; and Glycosyl transferase family 2. Is an ortholog of C. elegans F13G3.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21893.1	CBG21893.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21893	CBG21893		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068847
• Remark: CBG21893, TCTTTTTGATAAAGTCGGTGGATTTCGAACAGATGTTTCAGTAGGATTCCCAGAAGATCT, WBGene00040565
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term